_____Tidal Bore_______Hopewell Rocks______Bay of Fundy
(For a larger image, click on any picture above.)
29. (Y)The Printing Press
The first printing press, made by Gutenburg
(For a larger image, click on the picture above.)
30. Mount Kilimanjaro in Tanzania
31. Victoria Falls in Zambia/Zimbabwe
32. Krakatoa Island in Indonesia
33. Television
The first television set, made by Phil Farnsworth in 1935
(For a larger image, click on the picture above.)
34. The Chicxulub Crater became the Gulf of Mexico
There is evidence that the Chicxulub Crater buried underneath the Yucatan
Peninsula is an ancient impact crater.
According to
a University of Arizona Chicxulub crater web page: "... a large 65
million years old impact crater was located on Mexico's Yucatan Peninsula. It is called Chicxulub
- a Maya word that roughly translates as "tail of the devil." The crater,
now buried beneath a kilometer-thick sequence of sediments, ... appears to
have a diameter of 145 to 180 km, which makes it one of the largest
confirmed impact structures on Earth.
Some scientists believe that it also annihilated the dinosaurs.
(For a larger image, click on the picture above.)
35. The Human Genome
Scientists have been working for years to document all of the "genes" in all of the human chromosomes. This project is finally complete. The basic "genes" have been named A,G,T and C. (See Wonder #18 above.) The first 250 "genes" in the human Y chromosome are listed below. The full set of genes in the Human Y Chromosome would occupy approximately 1 million rows similar to those shown below, which amounts to about 50 million characters. This information is readily available on the Web. I have successfully downloaded all the 50 million characters which make up a typical Y chromosome. (Did you known that cells in the body of a male typically have an X and a Y chromosome each? Women's cells have 2 X chromosomes but no Y chromosome.)
GAATTCTAGGCTTTCTTTGAAGAGGTAGTAATCTGTAGCCCTCACCTAGG
ACTACAAGGTCATTTTTTAAAAAATAGCTAAGAAAACACATGTCTGGCAT
GTTTATCTCAGGCCATCGTTCTTGGCCTTCTAGAGAGTTAATGTCTACTA
TGTCACTTCATCAGGGAGGGGTAGTTAAGCTTGAAAAATCTTTCTATGAC
ATGACTGTGTCCTGCACATATTAAAAACTGGCCGAGTGAACACACCACCG

36. Stonehenge in England
(For a larger image, click on the left-most picture.)
37. Electronic Silicon Chips
This silicon chip will produce about 3000 integrated circuits (ICs).
(To enlarge it, click on the picture above.)
38. The Panama Canal
39. The Mars Rover
For a map of Mars, click on the picture above.
40. Quantuum Mechanics
41. Taj Mahal in Agra in India
42. The Statue of Liberty in New York

43. (Y)The Internal Combustion Engine
44. Manned Apollo Moon Landing
45. The Inca city of Manchu Picchu, Peru
46. Ancient Viking Settlement at L'Anse aux Meadows, Newfoundland, Canada
47. Exploration of the Pacific Trench
48. The Throne Hall of Persepolis in Iran
49. Niagara Falls in Ontario and New York
The energy in the Niagra Falls is used to produce electricity.
(To enlarge it, click on the picture above.)
50. The first nuclear-powered submarine:The Nautilus
51. The Panama Canal
52. (Y)CN Tower in Toronto, Canada
53. (Y)Golden Gate Bridge in San Francisco, USA
54. Itaipu Hydro-Electric Dam (Brazil & Paraguay)
55. Petronus Towers in Kuala Lumpar, Malaysia
56. (Y)The reclaiming of land in the Netherlands
57. (Y)The Northern Lights
58. Lake Bailcal in Russia
(This lake contains more water than all the Great Lakes combined.)
59. Nazca Lines in Peru
Huge line drawings were created by Inca indians around the year 525 AD. A good example is the spider shown above. It measures some 150 feet in length formed by one continuous line.
For more information: www.onagocag.com/nazca.html
60. (Y)Las Vegas in Nevada, USA
61. Marrakech in Morroco (Mosque, Gardens and Square)
62. Crazy Horse Memorial in South Dakota, USA
When finished, this will be the largest sculpture ever made.
(To enlarge it, click on the picture above.)
63. Bahai Garden & Shrine at Mount Carmel in Haifa, Israel
64. The Ice Hotel at Jukkas in Northern Sweden (rebuilt every winter)
65. Prophecies (e.g. 9/11) of Nostradamus (1503-1566)
........The year 1999 and September month
........From the sky will come the great King of Terror,
........He will awaken the great king of the Angolmois
........Before and after Mars to reign by good luck.
........................~ Nostradamus. X.72
(n.b. Mars was the Roman god of war)
Click on the verse (above) for an interpretation of it.
........L'an mil neuf cens nonante neuf sept mois
........Du ciel viendra un grand Roy d'effrayeur:
........Resusciter le grand Roy d'Angolmois
........Avant après Mars regner par bon heur.
...........(Untranslated Old French) Nostradamus. X.72
66. Crab Nebula
This Supernova Explosion began in the year 1054 AD.

Chinese astronomers recorded this explosion. For three weeks in 1054 AD, the new star, much brighter than Venus, could even be seen in daylight. Its explosion is now known to account for the origins of the Crab nebula, located in the constellation Taurus. The resulting Crab nebula was first observed in detail by Lord Rosse using a telescope in 1844. An astronomer named
Charles Messier catalogged the most interesting celestial objects. He numbered them from M1 to M110. The Crab Nebula is M1.
The American Indians in northern Arizona, may have been so inspired by the event that they drew pictures of it. Two pictographs have been found, one in a cave at White Mesa and the other on a wall of Navajo Canyon. Both show a crescent moon with a large star nearby. Scientists have calculated that on the morning of July 5, 1054, the Moon was located just 2 degrees north of the Crab Nebula's current position.
Brief Description
67. WikiPedia - The Web's Encyclopedia
Wikipedia is a living encyclopedia because anyone can add or modify it. It has been written in many different languages. It currently contains over 10,000 articles.
68. Google Earth
Google Earth is a map combined with a camera. If you enter someone's street address, you can see a photograph of the person's house as seen by a satellite. You can also ask that a map be combined with the photograph to see the names of the streets and rivers.
69.
70. Suggest your favorite wonder to "davidcole3@aol.com".
wonders_modern.html
last updated: 2010 B Feb 20